si:ch1073-404h7.1

Ensembl ID:
ENSDARG00000087299
ZFIN ID:
ZDB-GENE-100922-67
Human Orthologue:
ARMC9
Human Description:
armadillo repeat containing 9 [Source:HGNC Symbol;Acc:20730]
Mouse Orthologue:
Armc9
Mouse Description:
armadillo repeat containing 9 Gene [Source:MGI Symbol;Acc:MGI:1926045]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24216 Nonsense Available for shipment Available now
sa43882 Nonsense Mutation detected in F1 DNA During 2017
sa29834 Nonsense Mutation detected in F1 DNA During 2017
sa24217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24216
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 144 532 6 17
ENSDART00000132181 Nonsense 128 516 5 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39475209)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36621982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCTGTACCTGTCTCAGATTCCAGCTTTACTGCCATTTCTGCTGGACTG[T/A]CTGAAGACTGAAGAGAAAGAGTCTGTCACTCGAGAGAATGTGCTGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43882
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 249 532 9 17
ENSDART00000132181 Nonsense 233 516 8 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39479008)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36625781
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTGTTTTTTGTGGGTTTTTTAGATTCGGTATTATGTGAATGGAGCTT[T/A]ATACAGCATCCTGTCTGTGCCAGAGATACGAGAGGAAGCCAAACAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29834
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 264 532 9 17
ENSDART00000132181 Nonsense 248 516 8 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39479052)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36625825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTTTATACAGCATCCTGTCTGTGCCAGAGATACGAGAGGAAGCCAAA[C/T]AGATGGTACGTGTTTAACAGCTTCATTCACAGTTACAGTTACGCAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125991 Nonsense 525 532 16 17
ENSDART00000132181 Nonsense 509 516 15 16

The following transcripts of ENSDARG00000087299 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 39506936)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 36653709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGCAGCCGGCCCGGATCAGCAGGGGGCTCCAGTGGGCGACCGAGCCAA[C/T]AGAGTGAGTATTTCACCCAGCCTTCCCTCACAAACGGATACTCTTAAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link