ENSDARG00000087295

Ensembl ID:
ENSDARG00000087295
Human Orthologues:
AC055876.2, ZFYVE9
Human Description:
zinc finger, FYVE domain containing 9 [Source:HGNC Symbol;Acc:6775]
Mouse Orthologue:
Zfyve9
Mouse Description:
zinc finger, FYVE domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2652838]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa81 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa81
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125500 Nonsense 147 561 1 10
Genomic Location:
Chromosome 11 (position 13154342)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCCCCTCAATGGGTCCCTGATTCCCAGGCACCAGCATGCATGAAATGT[G/T]GATCCAAATTCTCCTTCACTAAAAGACGTCATCACTGCAGAGCATGTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3oxjvutj