LOC100149353

Ensembl ID:
ENSDARG00000087272
Human Orthologue:
TRPM6
Human Description:
transient receptor potential cation channel, subfamily M, member 6 [Source:HGNC Symbol;Acc:17995]
Mouse Orthologue:
Trpm6
Mouse Description:
transient receptor potential cation channel, subfamily M, member 6 Gene [Source:MGI Symbol;Acc:MGI:2

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14386 Nonsense Available for shipment Available now
sa6976 Nonsense Mutation detected in F1 DNA During 2014
sa7276 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa14386
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123535 Nonsense 369 1200 8 29
Genomic Location:
Chromosome 5 (position 26941449)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTTCATTTCAGATCAGCATTTTTGACTCTGAATCTGAAGACCTTCAA[G/T]AGGCAGAWGTTGMAATCCTGTCCACATCGCTGAGAGGTATGTCATGTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6976
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123535 Nonsense 387 1200 9 29
Genomic Location:
Chromosome 5 (position 26938367)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAGTGTTTGTTAYTCAAAATGAAAATACAGGGACGAGAGCTTCCCCC[G/T]AGGARCAGCTGAGTCTCACTCTGGCYTGGGACAGAGCTGATATTGCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123535 Nonsense 646 1200 15 29
Genomic Location:
Chromosome 5 (position 26934594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTTGGTCTATYAGAGAGTTTGGACAGTTGGCTGTGGATGTCCTGGAT[C/T]AGGCTTTCAGAGAGAATGAGCGCATGGCKATGAAGCTGCTGACCTGGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Magnesium levels: Genome-wide association studies of serum magnesium, potassium, and sodium concentrations identify six Loci influencing serum magnesium levels. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kc3s0ltt