kcnab2

Ensembl ID:
ENSDARG00000087247
Human Orthologue:
KCNAB2
Human Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 2 [Source:HGNC Symbol;Acc:622
Mouse Orthologue:
Kcnab2
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 2 Gene [Source:MGI Symbol;Acc

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41909 Essential Splice Site Mutation detected in F1 DNA During 2017
sa21974 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127292 Essential Splice Site 94 367 6 15
Genomic Location (Zv9):
Chromosome 11 (position 42748395)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41038890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGTAAGATGACCGATTAGTCTGATAAGCATCTGGTTTTGTGTTGCA[G/A]GGCGGAGGTGGTGCTGGGCAACGTCATAAAGAAGAAAGGATGGAGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127292 Nonsense 283 367 13 15
Genomic Location (Zv9):
Chromosome 11 (position 42783386)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41073881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAACAGGGCTACCAGTGGTTGAAGGACAAGATCTTGAGCGAGGAGGGC[C/T]GACGCCAGCAGGCGAAGCTGAAAGAGCTGCAGGCAATCGCTGAGCGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link