kcnab2

Ensembl ID:
ENSDARG00000087247
Human Orthologue:
KCNAB2
Human Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 2 [Source:HGNC Symbol;Acc:622
Mouse Orthologue:
Kcnab2
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, beta member 2 Gene [Source:MGI Symbol;Acc

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41909 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44747 Nonsense Mutation detected in F1 DNA During 2018
sa21974 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41909
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127292 Essential Splice Site 94 367 6 15
Genomic Location (Zv9):
Chromosome 11 (position 42748395)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41038890
GRCz11 11 41651120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGTAAGATGACCGATTAGTCTGATAAGCATCTGGTTTTGTGTTGCA[G/A]GGCGGAGGTGGTGCTGGGCAACGTCATAAAGAAGAAAGGATGGAGGTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44747
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127292 Nonsense 204 367 11 15
Genomic Location (Zv9):
Chromosome 11 (position 42766489)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41056984
GRCz11 11 41669214
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTCTATTATTTTGTCCATGTGTTGTAGGAAGCATATTCAGTGGCCCGA[C/T]AGTTCAACCAGATCCCACCAATCTGTGAGCAGTCGGAGTATCACATGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21974
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127292 Nonsense 283 367 13 15
Genomic Location (Zv9):
Chromosome 11 (position 42783386)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41073881
GRCz11 11 41686111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAACAGGGCTACCAGTGGTTGAAGGACAAGATCTTGAGCGAGGAGGGC[C/T]GACGCCAGCAGGCGAAGCTGAAAGAGCTGCAGGCAATCGCTGAGCGGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link