ENSDARG00000087237

Ensembl ID:
ENSDARG00000087237

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20774 Nonsense Mutation detected in F1 DNA During 2016
sa20775 Nonsense Available for shipment Available now
sa10440 Nonsense Available for shipment Available now
sa12753 Nonsense Available for shipment Available now
sa20776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 72 767 2 3
Genomic Location (Zv9):
Chromosome 6 (position 40408472)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40480072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACATGCTTCACAATAGCAAAAGTCTAAGTTCTCCAAACTCAAGAGAG[C/T]AAACACCGAAAGTGCACAGAAAAATTGTAGTGGAGCATAAGGGGTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 325 767 2 3
Genomic Location (Zv9):
Chromosome 6 (position 40409231)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40480831
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGGAAGAGTATGATGAAATGCAGATGGAAAAAGAGCTGATGGAGGAA[C/T]AAATAAACAAATCTGTTGCAGGCAATAAAGCTGCTATTCCCTCAAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 366 767 2 3
Genomic Location (Zv9):
Chromosome 6 (position 40409355)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40480955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATCTTCATCTTCTCAGACTTGTGTTCTTTCAGGGTCCGAWACAACCT[T/A]GGATGAAATAACAAATAACAACTACAATAGCAAAWATATGACTGAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 441 767 2 3
Genomic Location (Zv9):
Chromosome 6 (position 40409581)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40481181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACCTGAGTGAATCTGAAGGAAAAGAACTCATGGTAGACAATGYGTA[T/A]GAGGAGACAGAGCCAAAAATCCAAGCCAAGGACTTCCTCCAGAACAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 672 767 2 3
Genomic Location (Zv9):
Chromosome 6 (position 40410272)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 40481872
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCATATCGATTGAGCCAGGCTTCCTCTCTGAGCCCCTTCCCCTTTCC[A/T]AACCTCGATCATTTTCATCTCCGAATACAGATTCCTCTGAATACGAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link