ENSDARG00000087237

Ensembl ID:
ENSDARG00000087237

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20774 Nonsense Mutation detected in F1 DNA During 2014
sa20775 Nonsense Mutation detected in F1 DNA During 2014
sa10440 Nonsense Available for shipment Available now
sa12753 Nonsense Available for shipment Available now
sa20776 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 72 767 2 3
Genomic Location:
Chromosome 6 (position 40408472)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAACATGCTTCACAATAGCAAAAGTCTAAGTTCTCCAAACTCAAGAGAG[C/T]AAACACCGAAAGTGCACAGAAAAATTGTAGTGGAGCATAAGGGGTCACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20775
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 325 767 2 3
Genomic Location:
Chromosome 6 (position 40409231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGAGGAAGAGTATGATGAAATGCAGATGGAAAAAGAGCTGATGGAGGAA[C/T]AAATAAACAAATCTGTTGCAGGCAATAAAGCTGCTATTCCCTCAAACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10440
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 366 767 2 3
Genomic Location:
Chromosome 6 (position 40409355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATCTTCATCTTCTCAGACTTGTGTTCTTTCAGGGTCCGAWACAACCT[T/A]GGATGAAATAACAAATAACAACTACAATAGCAAAWATATGACTGAAAGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12753
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 441 767 2 3
Genomic Location:
Chromosome 6 (position 40409581)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACCTGAGTGAATCTGAAGGAAAAGAACTCATGGTAGACAATGYGTA[T/A]GAGGAGACAGAGCCAAAAATCCAAGCCAAGGACTTCCTCCAGAACAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20776
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121629 Nonsense 672 767 2 3
Genomic Location:
Chromosome 6 (position 40410272)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCCATATCGATTGAGCCAGGCTTCCTCTCTGAGCCCCTTCCCCTTTCC[A/T]AACCTCGATCATTTTCATCTCCGAATACAGATTCCTCTGAATACGAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/smzzuq01