OIT3

Ensembl ID:
ENSDARG00000087227
Description:
oncoprotein induced transcript 3 [Source:HGNC Symbol;Acc:29953]
Human Orthologue:
OIT3
Human Description:
oncoprotein induced transcript 3 [Source:HGNC Symbol;Acc:29953]
Mouse Orthologue:
Oit3
Mouse Description:
oncoprotein induced transcript 3 Gene [Source:MGI Symbol;Acc:MGI:1201782]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22205 Nonsense Mutation detected in F1 DNA During 2016
sa35408 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15373 Essential Splice Site Available for shipment Available now
sa16964 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128422 Nonsense 245 542 4 8
Genomic Location (Zv9):
Chromosome 13 (position 4352004)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4568733
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGTTAATGGAGGCTGTAGCCATGGATGCTCATCAGATGAAGACTCCTA[T/G]TACTGTCACTGTCCTTGGGGACTGATGTTGGGGGATGACAAACGGACCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35408
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128422 Essential Splice Site 263 542 4 8
Genomic Location (Zv9):
Chromosome 13 (position 4351948)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4568677
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACTGTCCTTGGGGACTGATGTTGGGGGATGACAAACGGACCTGTCAGG[G/A]TGAGCTAAACCAATTCTTCCAGCTTTTTCCTCTCTTTCTGTCAGAGTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128422 Essential Splice Site 488 542 7 8
ENSDART00000128422 Essential Splice Site 488 542 7 8
Genomic Location (Zv9):
Chromosome 13 (position 4340544)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4557273
KASP Assay ID:
2260-5969.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACACTACCAGGTCYCAGTCTTCAAGTTCATYGGCAAGGACAACAGA[G/A]TGAGTAGGGAACAGGTKCATGCTGGGACAATTCAGCTTGTGCTTTTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16964
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128422 Essential Splice Site 488 542 7 8
ENSDART00000128422 Essential Splice Site 488 542 7 8
Genomic Location (Zv9):
Chromosome 13 (position 4340544)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 4557273
KASP Assay ID:
2260-5969.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAACACTACCAGGTCYCAGTCTTCAAGTTCATYGGCAAGGACAACAGA[G/A]TGAGTAGGGAACAGGTKCATGCTGGGACAATTCAGCTTGTGCTTTTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link