LOC100330352

Ensembl ID:
ENSDARG00000087225
Human Orthologue:
TNFRSF9
Human Description:
tumor necrosis factor receptor superfamily, member 9 [Source:HGNC Symbol;Acc:11924]
Mouse Orthologue:
Tnfrsf9
Mouse Description:
tumor necrosis factor receptor superfamily, member 9 Gene [Source:MGI Symbol;Acc:MGI:1101059]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9873 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa9873
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124623 Essential Splice Site 29 272 1 7
Genomic Location:
Chromosome 6 (position 42938355)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCTGTTACTTCATAGAATTGGAAGCGCTACAGGAGAGTGTCTAGCAG[G/A]TATGTATGATTATGGTTATAWAATAWTTCTCTGTTGAGTTGAATGTAATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m7rojhk5