KCNE1

Ensembl ID:
ENSDARG00000087204
Description:
potassium voltage-gated channel, Isk-related family, member 1 [Source:HGNC Symbol;Acc:6240]
Human Orthologue:
KCNE1
Human Description:
potassium voltage-gated channel, Isk-related family, member 1 [Source:HGNC Symbol;Acc:6240]
Mouse Orthologue:
Kcne1
Mouse Description:
potassium voltage-gated channel, Isk-related subfamily, member 1 Gene [Source:MGI Symbol;Acc:MGI:966

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21537 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21537
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130176 Nonsense 25 127 1 2
Genomic Location (Zv9):
Chromosome 9 (position 36920732)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36058621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCATTCCCTGCTGGTTTCCTGGTTCCAGCAGTACTTTAATGAGAGCTG[G/A]TCAATAGGAGCAGCTCCACACGCATCTCCCCATCCTCCACCTGTGCATCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link