LOC100329854

Ensembl ID:
ENSDARG00000087203
Human Orthologue:
STK39
Human Description:
serine threonine kinase 39 [Source:HGNC Symbol;Acc:17717]
Mouse Orthologue:
Stk39
Mouse Description:
serine/threonine kinase 39, STE20/SPS1 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1858416]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17537 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125090 Nonsense 231 343 8 12
Genomic Location:
Chromosome 9 (position 50067792)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATATATACGTTCTGCATTYCCCCCCCCTCCTGCCTCTGTGTTGTAGAAT[C/T]GAGAGTACTTGATGGAAAAGCTGCTTACTAAAGGACCAAATATAAGCCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: From the Cover: Whole-genome association study identifies STK39 as a hypertension susceptibility gene. (View Study)
  • Parkinson's disease: Imputation of sequence variants for identification of genetic risks for Parkinson's disease: a meta-analysis of genome-wide association studies. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7vcrwsp4