fibin

Ensembl ID:
ENSDARG00000087196
ZFIN ID:
ZDB-GENE-050417-423
Description:
Fin bud initiation factor [Source:UniProtKB/Swiss-Prot;Acc:A1IGX5]
Human Orthologue:
FIBIN
Human Description:
fin bud initiation factor homolog (zebrafish) [Source:HGNC Symbol;Acc:33747]
Mouse Orthologue:
Fibin
Mouse Description:
fin bud initiation factor homolog (zebrafish) Gene [Source:MGI Symbol;Acc:MGI:1914856]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34113 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34113
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123498 Nonsense 30 210 1 1
Genomic Location (Zv9):
Chromosome 7 (position 35633353)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 34019228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTGCTCTCAATGCGTGTCGGAGGAGCCTTTTTTGCGGGACCCCTGTA[T/A]CCAGAGATGTCCAACGGCACGTTTCATCATTATTTCGTGCCGGACGGCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link