RORC

Ensembl ID:
ENSDARG00000087195
Description:
RAR-related orphan receptor C [Source:HGNC Symbol;Acc:10260]
Human Orthologue:
RORC
Human Description:
RAR-related orphan receptor C [Source:HGNC Symbol;Acc:10260]
Mouse Orthologue:
Rorc
Mouse Description:
RAR-related orphan receptor gamma Gene [Source:MGI Symbol;Acc:MGI:104856]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7784 Nonsense Mutation detected in F1 DNA During 2014
sa17968 Essential Splice Site Available for shipment Available now
sa13691 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7784
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128798 Nonsense 108 480 4 11
Genomic Location:
Chromosome 16 (position 20047894)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATTCACTATTTGCAGAAGTTGAGAGACATCGCCAGCATCAGCGTCTT[C/T]AAGCCAACTCAGTCCAGGAGCCCCAACCTCTCCAAGCCTACCGATCCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128798 Essential Splice Site 390 480 10 11
Genomic Location:
Chromosome 16 (position 20150188)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTAAATTAGGATAGACTAACTCTCTTTTTATTCTCTGCATTTTTCAAT[A/C]GATCGACCATGTCTGGAGGACAGGGAAAGARTTCAGAGAGTAAGGACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13691
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128798 Nonsense 430 480 11 11
Genomic Location:
Chromosome 16 (position 20150415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGGCTTTTAACTGGTAATTTTGTTTTTGTGTGATTGCAGCTGTATCAG[A/T]GAGTGCCGGTGTWGAGGTCTATGTGTGCACTGCATATTGAGAAACTGCAW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/arz9kckk