agxt2

Ensembl ID:
ENSDARG00000087194
ZFIN ID:
ZDB-GENE-050913-100
Description:
alanine--glyoxylate aminotransferase 2, mitochondrial [Source:RefSeq peptide;Acc:NP_001028922]
Human Orthologue:
AGXT2
Human Description:
alanine--glyoxylate aminotransferase 2 [Source:HGNC Symbol;Acc:14412]
Mouse Orthologue:
Agxt2
Mouse Description:
alanine-glyoxylate aminotransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2146052]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23861 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23861
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122370 Nonsense 67 484 2 17
Genomic Location:
Chromosome 21 (position 9082288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGTAACCTACTACAAGAAGCCGGTCTTCATAAACCAGGGCCACATG[C/T]AGTGGTTGTGGGACGTGGACGGAAGGCGATATCTGGACTTGTTCGCAGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7g3vc6qc