PRRG2

Ensembl ID:
ENSDARG00000087193
Description:
proline rich Gla (G-carboxyglutamic acid) 2 [Source:HGNC Symbol;Acc:9470]
Human Orthologue:
PRRG2
Human Description:
proline rich Gla (G-carboxyglutamic acid) 2 [Source:HGNC Symbol;Acc:9470]
Mouse Orthologue:
Prrg2
Mouse Description:
proline-rich Gla (G-carboxyglutamic acid) polypeptide 2 Gene [Source:MGI Symbol;Acc:MGI:1929596]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7546 Missense, Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125105 Missense, Splice Site 187 209 6 7
Genomic Location (Zv9):
Chromosome 3 (position 32560929)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 32292239
KASP Assay ID:
554-4205.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAAAATGTGAATGTGTTTTAAAATATCCCTCTCTGCTCTTTACAGGA[C/T]GACTCCAACTGCACCACCGTAATCTCAAAATGAGGAATGAGCAATGANTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link