grip2l

Ensembl ID:
ENSDARG00000087187
ZFIN ID:
ZDB-GENE-081104-132
Human Orthologue:
GRIP1
Human Description:
glutamate receptor interacting protein 1 [Source:HGNC Symbol;Acc:18708]
Mouse Orthologue:
Grip1
Mouse Description:
glutamate receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1921303]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21193 Essential Splice Site Mutation detected in F1 DNA During 2014
sa883 Nonsense F2 line generated During 2014
sa3680 Nonsense Mutation detected in F1 DNA During 2014
sa15003 Essential Splice Site Available for shipment Available now
sa21192 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21193
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128485 None None 85 None 3
ENSDART00000132009 Essential Splice Site 174 734 None 18
ENSDART00000145345 None None 127 None 3

The following transcripts of ENSDARG00000087187 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 7797421)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCGCCGGCTGCCATCCGCTTTATAGAGCCTGACACACCTGCTGAACGG[T/C]GAGAGCAGAGCGCACCTCATGTGTGCTCAACACACTGTGCAATTTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa883
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128485 None None 85 None 3
ENSDART00000132009 Nonsense 495 734 14 18
ENSDART00000145345 None None 127 None 3

The following transcripts of ENSDARG00000087187 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 7783006)
KASP Assay ID:
554-0790.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCGTATATATTCATAGGCCATCAGACTTCACTCTTCATCCCAGCGACTG[G/A]AGACAGACCAATCACAGGAGCCCGCTGATGTCAAGAAGACCCGCCCACCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3680
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128485 None None 85 None 3
ENSDART00000132009 Nonsense 552 734 15 18
ENSDART00000145345 None None 127 None 3

The following transcripts of ENSDARG00000087187 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 7780043)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGGCCACAACTACAACAGTACAACAGACGCTCAGGAGAACTATTGGTCA[C/T]AAGCTCTTCAGGACCTGGAGACCTGCGGTCAGTCAGAAATCCTGCGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15003
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128485 None None 85 None 3
ENSDART00000132009 Essential Splice Site 624 734 16 18
ENSDART00000145345 None None 127 None 3

The following transcripts of ENSDARG00000087187 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 7776559)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CWGAGGACCTRAAGGRGAACAGCCCGTCAGTGCCTCTAGAGCTTCATAAG[G/A]TAATGTTCACCTTCCAGCAGCTGGATTCACGTCTTGAACTCTTGCTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21192
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128485 None None 85 None 3
ENSDART00000132009 Nonsense 716 734 18 18
ENSDART00000145345 None None 127 None 3

The following transcripts of ENSDARG00000087187 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 8 (position 7776060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTCATTAGCAGGAATCCTCTCGCTCAGGCGCACGACTGGCCACCT[A/T]AAGACTGTCAGGACACTTCCCAACAGTCTGCACAAAATCCAAGAAAAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/o4710qv5