ENSDARG00000087183

Ensembl ID:
ENSDARG00000087183

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38171 Nonsense Mutation detected in F1 DNA During 2017
sa38170 Nonsense Mutation detected in F1 DNA During 2017
sa30500 Nonsense Mutation detected in F1 DNA During 2017
sa30499 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130296 Nonsense 407 1449 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA160 (position 3540)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149789.1 3540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAAAAGCTAGTTAATTGCAACATTCTCAAGAGTGGGATGTATTCTT[C/A]GTCGGAGGAGTTCAGGTCTTCTTGGTTAAACATTGATGGACAGCCAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38170
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130296 Nonsense 618 1449 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA160 (position 2906)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149789.1 2906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGAAAAGCCAGACAATACTAAGACTCTTAATAACTCCTCAGAAACCTG[G/A]CCGGTAGAAGATATTTCTGAAGATGAAAATTCTGGAAATAAGGATGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30500
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130296 Nonsense 632 1449 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA160 (position 2866)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149789.1 2866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAACCTGGCCGGTAGAAGATATTTCTGAAGATGAAAATTCTGGAAAT[A/T]AGGATGTTCCTCCTAATGCCACAGACACCTGGATTGTTGAAGATATTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30499
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130296 Nonsense 956 1449 1 1
Genomic Location (Zv9):
Chromosome Zv9_NA160 (position 1894)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149789.1 1894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACAAGAAACCAAATGTTGATGCACCTGTGACATGCATTGCAGAGGAA[G/T]GATTGACCATACCAAAAAGAGACAGTGTTGTAAAATCACAACTGGGAGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link