scpp9

Ensembl ID:
ENSDARG00000087178
ZFIN ID:
ZDB-GENE-090424-3
Description:
secretory calcium-binding phosphoprotein 9 [Source:RefSeq peptide;Acc:NP_001138717]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16657 Essential Splice Site Available for shipment Available now
sa38285 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa16657
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129813 Essential Splice Site 151 183 7 9
Genomic Location (Zv9):
Chromosome 1 (position 44353268)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43269584
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAATAATCAAGCCGTTGGGTTGCCACAAGGCTCACTGGGAAGATTTAAGG[T/A]ATCTTTTGTGATGCAGTTTTATGTTATATAAGTTATAGTGTATAGTAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129813 Essential Splice Site 152 183 8 9
Genomic Location (Zv9):
Chromosome 1 (position 44352824)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 43269140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATCTATTTGCCATCTTAAATCCTTCCTCCTTTTCTTCTTTCTCCTCA[G/A]CGATCATTTATCAGAAGGACCACAGCAAGACCACCTGTCTCAGTCACCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link