LOC564886

Ensembl ID:
ENSDARG00000087145
Human Orthologue:
PARP10
Human Description:
poly (ADP-ribose) polymerase family, member 10 [Source:HGNC Symbol;Acc:25895]
Mouse Orthologues:
Parp10, Zc3hav1
Mouse Descriptions:
poly (ADP-ribose) polymerase family, member 10 Gene [Source:MGI Symbol;Acc:MGI:3712326]
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23477 Nonsense Available for shipment Available now
sa9947 Nonsense Available for shipment Available now
sa43246 Nonsense Mutation detected in F1 DNA During 2016
sa39238 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123409 Nonsense 25 581 2 6
Genomic Location (Zv9):
Chromosome 19 (position 12589097)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12047443
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTGATCCTTTAGAGTTAATTGCACTTGTGTTTTCCACAGGATATTT[T/A]GGAGCTGGCATGGAAAATGACACCCTGTCAGAACTTCCAGAAGAGTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123409 Nonsense 177 581 3 6
Genomic Location (Zv9):
Chromosome 19 (position 12587393)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12045739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAWCCAGAAAGCTCTAGAACTTTCCAAGAGGGACTCCGTACCAAGGGAG[G/T]AGAACAAACAGCTGGAGATGGCRTTTGAAATGTCAATGGAGGAAGCCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123409 Nonsense 367 581 3 6
Genomic Location (Zv9):
Chromosome 19 (position 12586823)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12045169
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATGGAAGAGCACAGTTTGGCATCTGGGAAATCTGTGCCTATTAAACGA[A/T]AAATGATGAGCACAGAGGACTTGTACACAGACGGTGCAGGTAGGAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39238
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123409 Nonsense 491 581 6 6
Genomic Location (Zv9):
Chromosome 19 (position 12579073)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12037419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGATTTTTTTTCTTCTCTTCCAGCCACTGTATACGGTCAGGGTGTGTA[T/A]TTTGCGGTCAACGCCTCTCTGTCTGTGTCAGACACCTACTCTCCACCTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link