LOC564886

Ensembl ID:
ENSDARG00000087145
Human Orthologue:
PARP10
Human Description:
poly (ADP-ribose) polymerase family, member 10 [Source:HGNC Symbol;Acc:25895]
Mouse Orthologues:
Parp10, Zc3hav1
Mouse Descriptions:
poly (ADP-ribose) polymerase family, member 10 Gene [Source:MGI Symbol;Acc:MGI:3712326]
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23477 Nonsense Mutation detected in F1 DNA During 2014
sa9947 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123409 Nonsense 25 581 2 6
Genomic Location:
Chromosome 19 (position 12589097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGTGATCCTTTAGAGTTAATTGCACTTGTGTTTTCCACAGGATATTT[T/A]GGAGCTGGCATGGAAAATGACACCCTGTCAGAACTTCCAGAAGAGTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9947
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123409 Nonsense 177 581 3 6
Genomic Location:
Chromosome 19 (position 12587393)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAWCCAGAAAGCTCTAGAACTTTCCAAGAGGGACTCCGTACCAAGGGAG[G/T]AGAACAAACAGCTGGAGATGGCRTTTGAAATGTCAATGGAGGAAGCCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m0bpd32z