LOC792834

Ensembl ID:
ENSDARG00000087144
Human Orthologues:
FAM183A, FAM183B
Human Descriptions:
family with sequence similarity 183, member A [Source:HGNC Symbol;Acc:34347]
family with sequence similarity 183, member B [Source:HGNC Symbol;Acc:34511]
Mouse Orthologue:
Fam183b
Mouse Description:
family with sequence similarity 183, member B Gene [Source:MGI Symbol;Acc:MGI:1922679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14186 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127063 Nonsense 93 135 3 4
Genomic Location:
Chromosome 6 (position 33837900)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACAAAGAAGTACACTCACCCTCAGACTGAATCACAGGAGATAGGATG[G/A]TTATCTAGTCCTCTGGTAGGTACATATTAATTCAWGTTTGAATGTTTNNN
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zksbyj42