ENSDARG00000087133

Ensembl ID:
ENSDARG00000087133
Human Orthologues:
NLGN4X, NLGN4Y
Human Descriptions:
neuroligin 4, X-linked [Source:HGNC Symbol;Acc:14287]
neuroligin 4, Y-linked [Source:HGNC Symbol;Acc:15529]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35029 Essential Splice Site Mutation detected in F1 DNA During 2017
sa35028 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35029
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123359 Essential Splice Site 166 304 1 3
Genomic Location (Zv9):
Chromosome 11 (position 10037417)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 9964373
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAGTGAGGACTGCTTATTCTTAAACATATACGTGCCAACGGAGGATGG[T/A]GAGTAAATGTGCGGGCAGGATGGACAGACCTGCCTTTGTCATCTCACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35028
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123359 Essential Splice Site 185 304 2 3
Genomic Location (Zv9):
Chromosome 11 (position 10036830)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 9963786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCAAGGAATGTGCCAGAAAACCCGGCAAGAAAATATGTAGAAAAGGAG[G/A]TATGTATCCACCGACATAAAACCCAAAAGAGAACAGGCAAAGATCTCCCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link