ENSDARG00000087122

Ensembl ID:
ENSDARG00000087122

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5413 Nonsense Mutation detected in F1 DNA During 2014
sa7063 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122800 Nonsense 655 828 10 13
Genomic Location:
Chromosome 7 (position 26012483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAGGAGTTTGAACCTGAAATAGCTGTAATTAATGGCGAGATTTCCTA[T/A]AGGTGAGTAAAGAATGTCTYTTTTTTATATTCATAATTTCAAATTCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122800 Nonsense 716 828 11 13
Genomic Location:
Chromosome 7 (position 26011816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCTGCCGGACCTCTGTTTGATATCAAAACCCCTGCAGGAGAAATCTA[T/A]GAACTTCATCTCCCACACTGTGAAACACATGGTAAATGACAACACTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ekl2xb82