ENSDARG00000087122

Ensembl ID:
ENSDARG00000087122

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26949 Nonsense Mutation detected in F1 DNA During 2016
sa7063 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa26949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122800 Nonsense 144 828 3 13
Genomic Location (Zv9):
Chromosome 7 (position 26018273)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24580025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGACAAAGAAATGCACCCTATAACTGTGGAAGAACTGTCTGTGGTTT[T/A]GTCGGACTGTAATTTGCAAAAAAGAGAACTTTGTCAGCTATTAAGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122800 Nonsense 716 828 11 13
Genomic Location (Zv9):
Chromosome 7 (position 26011816)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 24573568
KASP Assay ID:
554-4817.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCTGCCGGACCTCTGTTTGATATCAAAACCCCTGCAGGAGAAATCTA[T/A]GAACTTCATCTCCCACACTGTGAAACACATGGTAAATGACAACACTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link