ENSDARG00000087122

Ensembl ID:
ENSDARG00000087122

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa26949 Nonsense Mutation detected in F1 DNA During 2015
sa5413 Nonsense Mutation detected in F1 DNA During 2015
sa7063 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa26949
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122800 Nonsense 144 828 3 13
Genomic Location:
Chromosome 7 (position 26018273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGACAAAGAAATGCACCCTATAACTGTGGAAGAACTGTCTGTGGTTT[T/A]GTCGGACTGTAATTTGCAAAAAAGAGAACTTTGTCAGCTATTAAGCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5413
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122800 Nonsense 655 828 10 13
Genomic Location:
Chromosome 7 (position 26012483)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTAAAGGAGTTTGAACCTGAAATAGCTGTAATTAATGGCGAGATTTCCTA[T/A]AGGTGAGTAAAGAATGTCTYTTTTTTATATTCATAATTTCAAATTCAGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122800 Nonsense 716 828 11 13
Genomic Location:
Chromosome 7 (position 26011816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCCTGCCGGACCTCTGTTTGATATCAAAACCCCTGCAGGAGAAATCTA[T/A]GAACTTCATCTCCCACACTGTGAAACACATGGTAAATGACAACACTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ekl2xb82