LOC100329285

Ensembl ID:
ENSDARG00000087120
Human Orthologue:
SLC5A8
Human Description:
solute carrier family 5 (iodide transporter), member 8 [Source:HGNC Symbol;Acc:19119]
Mouse Orthologue:
Slc5a8
Mouse Description:
solute carrier family 5 (iodide transporter), member 8 Gene [Source:MGI Symbol;Acc:MGI:2384916]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38423 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38423
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121936 Nonsense 92 277 3 7
Genomic Location (Zv9):
Chromosome 4 (position 5726808)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5844989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATACAAAACAATTGTATGTATTTTTTTCAACAGGCGGCTTTCAGTATTT[C/A]AGGAGTGATTGGTGGACCTCTGCTAGGCCTATTTTCTCTTGCAATCCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link