si:ch211-86k6.4

Ensembl ID:
ENSDARG00000087110
ZFIN ID:
ZDB-GENE-091204-370
Human Orthologue:
AKNA
Human Description:
AT-hook transcription factor [Source:HGNC Symbol;Acc:24108]
Mouse Orthologue:
Akna
Mouse Description:
AT-hook transcription factor Gene [Source:MGI Symbol;Acc:MGI:2140340]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37255 Essential Splice Site Available for shipment Available now
sa39322 Nonsense Mutation detected in F1 DNA During 2017
sa12466 Essential Splice Site Available for shipment Available now
sa9769 Essential Splice Site Available for shipment Available now
sa43603 Nonsense Mutation detected in F1 DNA During 2017
sa11369 Nonsense Available for shipment Available now
sa43602 Nonsense Mutation detected in F1 DNA During 2017
sa43601 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43600 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 118 1452 2 23
ENSDART00000140413   None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12164930)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13866104
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAACCGCTCTCTCAGGCCACTGGAGACCACTACTACTCTCCATCACTGC[G/T]TAAAAGGCTCAGTTTAATTAAACATCCATAACTAATTTTACAAATATAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 336 1452 3 23
ENSDART00000140413   None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12162513)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13863687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGCCCTGAAAAAATATACCAAGATGCTACGAGTGGCGAAAAATTAGAT[G/T]GAAGGTTACACAGGCCTTACCACAATCTGCAGCCTCCAACAGTCTCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12466
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 692 1452 None 23
ENSDART00000140413   None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12147568)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13848742
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATGCTGCAGCAACNNNAAGGCRGACATGCCATCTTTGACCCAGACAGG[T/C]AGCCATTTTTTAAATGTTGGTGTACAGATATTGTAAAAAACAGAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413   None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413   None 253 None 4
ENSDART00000127705 Essential Splice Site 747 1452 10 23
ENSDART00000140413   None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12145961)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13847135
KASP Assay ID:
2261-5376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGATGTSCTTTCTGCATCCATGCTGGAGCCTGAACCAGTGCCTGAG[G/A]TTCCTCAAAATKACTCCTAAACATCACTCACATATGACCTCATGGGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 805 1452 12 23
ENSDART00000140413   None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12144549)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13845723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCTTGATATTTCAATATCTCTTTCTCATGGTCTTCTCACCTTCAGCTA[T/A]CAGAGTGTTAAAGAGCTCCCCGGGACACTGGATCAGGCTGTGACTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11369
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 1030 1452 15 23
ENSDART00000140413 Nonsense 209 253 4 4
Genomic Location (Zv9):
Chromosome 21 (position 12137985)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13839159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCACAAAAAAGCACATTGRTACATCAGGAAAATGCACAGGTCCKTA[T/G]AAGAAAATAGGAGGGGAGGAAAGGTGTTCTTTTTCCAGTCTTTCTTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43602
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 1105 1452 16 23
ENSDART00000140413   None 253 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12135946)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13837120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAATCAGCAACTCCGCTCTCACAGAAGCCCCTCCCTCCACAGGCCTTA[T/A]CACCACAGTTCTGCTCAGCTAACAAATCACCAGTGAGTTTCCTAAAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Essential Splice Site 1325 1452 21 23
ENSDART00000140413   None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12129240)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13830414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCCATTGTGTGGTGCATTACAAGCCATTCAAAGAGCCTCTAAGCCAG[G/A]TTTGGTGCTTCATTATCTATATATGAAATGCTTTCATTAAACTTTTCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43600
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127705 Nonsense 1408 1452 23 23
ENSDART00000140413   None 253 None 4
Genomic Location (Zv9):
Chromosome 21 (position 12126258)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 13827432
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCATCAAATCCCGTCAGGCCTGAGAGGTCAGGGGTCAGAGGTCACCGC[A/T]GACGCTCTTCCTCCATGGAGTATCATCAGGATTCTATGAGCAGCGCTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link