TTC28 (1 of 2)

Ensembl ID:
ENSDARG00000087109
Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]
Human Orthologue:
TTC28
Human Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17154 Essential Splice Site Available for shipment Available now
sa13074 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129007 Essential Splice Site 59 1132 3 12
Genomic Location:
Chromosome 10 (position 4034036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACTTTTAAATATGTGTTTTGCATGAAAAATGACTRTGTTTTTCTTTGT[A/G]GGGTCTAATGCATTCCAGTGGTCCGGTGGGTCGACACAGGCAGCTGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129007 Nonsense 725 1132 12 12
Genomic Location:
Chromosome 10 (position 4046264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGCTCATCTCCACATGGAGCCKTTGGAGGACATGAGGATGAAGAGTA[C/A]RAAGGATACAGTATAATCAGTAGCGAGCCAYTAGGTAGCCAATGTGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/78bl71s4