TTC28 (1 of 2)

Ensembl ID:
ENSDARG00000087109
Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]
Human Orthologue:
TTC28
Human Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17154 Essential Splice Site Available for shipment Available now
sa27540 Essential Splice Site Mutation detected in F1 DNA During 2015
sa13074 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17154
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129007 Essential Splice Site 59 1132 3 12
Genomic Location:
Chromosome 10 (position 4034036)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACTTTTAAATATGTGTTTTGCATGAAAAATGACTRTGTTTTTCTTTGT[A/G]GGGTCTAATGCATTCCAGTGGTCCGGTGGGTCGACACAGGCAGCTGGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27540
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129007 Essential Splice Site 515 1132 8 12
Genomic Location:
Chromosome 10 (position 4045062)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTAAACTGATCACGGCTTCAGAAACCGGAGAACAGCTGATCAACCGG[G/A]TGAGATGTCACACACCATGAATCCAAAACACTTTAATATTCATTAAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129007 Nonsense 725 1132 12 12
Genomic Location:
Chromosome 10 (position 4046264)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCGCTCATCTCCACATGGAGCCKTTGGAGGACATGAGGATGAAGAGTA[C/A]RAAGGATACAGTATAATCAGTAGCGAGCCAYTAGGTAGCCAATGTGACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/78bl71s4