ENSDARG00000087101

Ensembl ID:
ENSDARG00000087101
Human Orthologue:
VPRBP
Human Description:
Vpr (HIV-1) binding protein [Source:HGNC Symbol;Acc:30911]
Mouse Orthologue:
Vprbp
Mouse Description:
Vpr (HIV-1) binding protein Gene [Source:MGI Symbol;Acc:MGI:2445220]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38226 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38226
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130193 Nonsense 22 130 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA928 (position 42633)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149868.1 42633
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGCGGTGTGGACTCTAAAGCGGAGCTCAGTACTCTGCTGGAGCAGTG[G/A]GAGAGAGAGCAGCAGGGGGCGTCCAGCGAGCTGCTCAACATACTCACCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link