NTNG2 (2 of 2)

Ensembl ID:
ENSDARG00000087100
Description:
netrin G2 [Source:HGNC Symbol;Acc:14288]
Human Orthologue:
NTNG2
Human Description:
netrin G2 [Source:HGNC Symbol;Acc:14288]
Mouse Orthologue:
Ntng2
Mouse Description:
netrin G2 Gene [Source:MGI Symbol;Acc:MGI:2159341]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9458 Nonsense Available for shipment Available now
sa23847 Nonsense Available for shipment Available now
sa37213 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9458
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124030 Nonsense 189 1579 6 10
Genomic Location (Zv9):
Chromosome 21 (position 4169542)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3844542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATATTATTAGTCACCAGTGCATCTGTCACACCAGCACCTGAACCTKTT[G/T]GATCAGTGCSGGAGTCTGCCGAGCCAAAGCCAGAGTCGATTCCRAAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23847
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124030 Nonsense 276 1579 6 10
Genomic Location (Zv9):
Chromosome 21 (position 4169804)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3844280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGAGACTATACAGAAACCTCATGAACCAAAAGTGAATTCTCATGAAT[C/A]AATGCATAAACCCCATGAGCAAATTGTAAATCTTAATGAATCAATGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37213
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124030 Essential Splice Site 1406 1579 7 10
Genomic Location (Zv9):
Chromosome 21 (position 4173899)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3840185
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGAAACAGACTGTACAGCTAAAAGGCATCATATATGACGACTTTCAAG[G/A]TGAGAAAGAATCACAAATGGAATGAGAAAATGAAGATGTTTATTTGATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link