si:ch211-274p24.4

Ensembl ID:
ENSDARG00000087088
ZFIN ID:
ZDB-GENE-091204-337
Mouse Orthologue:
E130309D14Rik
Mouse Description:
RIKEN cDNA E130309D14 gene Gene [Source:MGI Symbol;Acc:MGI:3588240]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9020 Nonsense Mutation detected in F1 DNA During 2017
sa43701 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125879 Nonsense 25 280 1 4
ENSDART00000139677 Nonsense 25 280 2 5
Genomic Location (Zv9):
Chromosome 21 (position 38173931)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39294010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAGGTGGAGAGTGTTGAGCGCAATGTAGCGTTTTTGCAGGAGGAGCAC[C/T]RAATCCTCCTCACGGGTCTGCRGCTGGAGATACGCAACCTTAAGAAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43701
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125879 Nonsense 95 280 3 4
ENSDART00000139677 Nonsense 95 280 4 5
Genomic Location (Zv9):
Chromosome 21 (position 38176420)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 39296499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTGGCTGAGCAGGAAAGTGCGCTGGTGGAGCTGCGGGCAGAGCTGAGG[A/T]AAAAAGGAGCAATCGCAAGCGCACTACAAGTCCGTCTTCGAGATGAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link