MGAT5B (1 of 2)

Ensembl ID:
ENSDARG00000087086
Description:
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B [Source:HGNC
Human Orthologue:
MGAT5B
Human Description:
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B [Source:HGNC
Mouse Orthologue:
Mgat5b
Mouse Description:
mannoside acetylglucosaminyltransferase 5, isoenzyme B Gene [Source:MGI Symbol;Acc:MGI:3606200]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8149 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126107 Essential Splice Site 102 422 4 9
Genomic Location:
Chromosome 3 (position 59784801)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTAGACCTTCATCTCTCCATCTCTCATCTTTTCYTYATCTYTTCTGC[A/T]GGGAAAGGAGAAATTGCTYTCCATCCTGCACCGCTACATGGACATCCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ay089s7y