si:ch211-87d12.1

Ensembl ID:
ENSDARG00000087074
ZFIN ID:
ZDB-GENE-100922-259
Description:
si:ch211-87d12.1 [Source:RefSeq peptide;Acc:NP_001164307]
Human Orthologue:
ZNF574
Human Description:
zinc finger protein 574 [Source:HGNC Symbol;Acc:26166]
Mouse Orthologue:
Zfp574
Mouse Description:
zinc finger protein 574 Gene [Source:MGI Symbol;Acc:MGI:2442951]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36056 Nonsense Available for shipment Available now
sa4643 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa36056
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125158 Nonsense 240 1008 3 7
Genomic Location (Zv9):
Chromosome 16 (position 13017662)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11422898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGAAGAAGGCCAAACCCCCCTCCAGCCTGCTCTGTGTGGAGTGTGGA[C/T]AAAGCTTCAGTCTGGTTCCAGAGCTCGTGACTCACCGCAGGACTCAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4643
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125158 Nonsense 714 1008 6 7
Genomic Location (Zv9):
Chromosome 16 (position 13044355)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 11449591
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCTGAATCAGACAGTGCTGGACACACACCTGCAGCGCTGCACGGGGGAG[C/T]AGACGGGACAGCGCAAATATAAAGGGCAGGGAAGAGGCAAGGTAGGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link