URB1 (2 of 2)

Ensembl ID:
ENSDARG00000087043
Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Human Orthologue:
URB1
Human Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Mouse Orthologue:
Urb1
Mouse Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146468]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10519 Nonsense Available for shipment Available now
sa42481 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Nonsense 44 1605 1 31
Genomic Location (Zv9):
Chromosome 15 (position 5614266)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5732603
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTAGTGGCACTGTTTTTAAATCYATGCTRAAGGATTCATCTGAAGCA[C/T]AGAAGGGTGAGTATTCTATCAAATCTTACWGTTSAAAACATMATTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Essential Splice Site 692 1605 16 31
Genomic Location (Zv9):
Chromosome 15 (position 5590144)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5708262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTTGGGTCTGTCCCAGCAGGAGACCGTCATACAGTTTCTAGACCATG[T/C]ACTGGATTTTGACCACTTGCATATGGTTTTACTGGGCATTTGTCATTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link