URB1 (2 of 2)

Ensembl ID:
ENSDARG00000087043
Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Human Orthologue:
URB1
Human Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Mouse Orthologue:
Urb1
Mouse Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146468]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10519 Nonsense Available for shipment Available now
sa7752 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Nonsense 44 1605 1 31
Genomic Location:
Chromosome 15 (position 5614266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTAGTGGCACTGTTTTTAAATCYATGCTRAAGGATTCATCTGAAGCA[C/T]AGAAGGGTGAGTATTCTATCAAATCTTACWGTTSAAAACATMATTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Nonsense 535 1605 13 31
Genomic Location:
Chromosome 15 (position 5595111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTGATRTTAAAATACTAAANATCTATTGTGCTTTTTCTCTTAAAGCA[C/T]AACAGGATGATCCACACCTCATCCTGGTCAAAGCTCTGCTTCTTCAAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ylqdqmug