URB1 (2 of 2)

Ensembl ID:
ENSDARG00000087043
Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Human Orthologue:
URB1
Human Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:17344]
Mouse Orthologue:
Urb1
Mouse Description:
URB1 ribosome biogenesis 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2146468]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10519 Nonsense Available for shipment Available now
sa7752 Nonsense Mutation detected in F1 DNA During 2016
sa42481 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10519
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Nonsense 44 1605 1 31
Genomic Location:
Chromosome 15 (position 5614266)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTAGTGGCACTGTTTTTAAATCYATGCTRAAGGATTCATCTGAAGCA[C/T]AGAAGGGTGAGTATTCTATCAAATCTTACWGTTSAAAACATMATTTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7752
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Nonsense 535 1605 13 31
Genomic Location:
Chromosome 15 (position 5595111)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTTGATRTTAAAATACTAAANATCTATTGTGCTTTTTCTCTTAAAGCA[C/T]AACAGGATGATCCACACCTCATCCTGGTCAAAGCTCTGCTTCTTCAAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063468 Essential Splice Site 692 1605 16 31
Genomic Location:
Chromosome 15 (position 5590144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGTTGGGTCTGTCCCAGCAGGAGACCGTCATACAGTTTCTAGACCATG[T/C]ACTGGATTTTGACCACTTGCATATGGTTTTACTGGGCATTTGTCATTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link