si:ch211-200e2.1

Ensembl ID:
ENSDARG00000087032
ZFIN ID:
ZDB-GENE-030131-3078
Human Orthologue:
C20orf151
Human Description:
chromosome 20 open reading frame 151 [Source:HGNC Symbol;Acc:16144]
Mouse Orthologue:
BC066135
Mouse Description:
cDNA sequence BC066135 Gene [Source:MGI Symbol;Acc:MGI:3606212]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31082 Nonsense Mutation detected in F1 DNA During 2017
sa43914 Nonsense Mutation detected in F1 DNA During 2017
sa19315 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31082
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551   None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074   None 185 None 2
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551   None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074   None 185 None 2
Genomic Location (Zv9):
Chromosome 23 (position 7562094)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7554557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCAAGGTGTCTCCTGATCCAGCTGTGTCCTCAGGGCTGAAGTCCTG[T/A]CAGCCTCCAGCAGGGGACGCCACTGTACCGGCAGCAACCGTCAAAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551   None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074   None 185 None 2
ENSDART00000126578 Nonsense 161 579 6 14
ENSDART00000135551   None 41 None 3
ENSDART00000137240 Nonsense 161 240 7 10
ENSDART00000138074   None 185 None 2
Genomic Location (Zv9):
Chromosome 23 (position 7562094)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7554557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGTCAAGGTGTCTCCTGATCCAGCTGTGTCCTCAGGGCTGAAGTCCTG[T/A]CAGCCTCCAGCAGGGGACGCCACTGTACCGGCAGCAACCGTCAAAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19315
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126578 Essential Splice Site 509 579 10 14
ENSDART00000135551   None 41 None 3
ENSDART00000137240   None 240 None 10
ENSDART00000138074   None 185 None 2
Genomic Location (Zv9):
Chromosome 23 (position 7572888)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7565351
KASP Assay ID:
554-6182.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCGCAGAGAACAAGAAAGTTCCTTCACTAACTATTTCCCTCCAACCAGG[T/C]AAAGCTGTATTTTTCATTAAGCATAAATGCAACAGTATTAACCAGGTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link