si:ch73-334d15.2

Ensembl ID:
ENSDARG00000087020
ZFIN ID:
ZDB-GENE-091204-158
Human Orthologue:
RAMP2
Human Description:
receptor (G protein-coupled) activity modifying protein 2 [Source:HGNC Symbol;Acc:9844]
Mouse Orthologue:
Ramp2
Mouse Description:
receptor (calcitonin) activity modifying protein 2 Gene [Source:MGI Symbol;Acc:MGI:1859650]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24542 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24542
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125267 Essential Splice Site 81 161 None 3
ENSDART00000147281 Essential Splice Site 48 128 None 2
Genomic Location (Zv9):
Chromosome 24 (position 38203577)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 36818243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTACTATCGACGAGCAGAACTGGTGTGTTATGGAGGTGGTTTTAAGG[T/A]AAGACTGAGCTTCTTTTTGTTTTACTCACACATTTAGCTAAAGCAGTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link