ENSDARG00000087019

Ensembl ID:
ENSDARG00000087019
Human Orthologues:
CGN, CGNL1
Human Descriptions:
cingulin [Source:HGNC Symbol;Acc:17429]
cingulin-like 1 [Source:HGNC Symbol;Acc:25931]
Mouse Orthologues:
Cgn, Cgnl1
Mouse Descriptions:
cingulin Gene [Source:MGI Symbol;Acc:MGI:1927237]
cingulin-like 1 Gene [Source:MGI Symbol;Acc:MGI:1915428]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39487 Nonsense Mutation detected in F1 DNA During 2016
sa30277 Nonsense Mutation detected in F1 DNA During 2016
sa8721 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15716 Nonsense Available for shipment Available now
sa11668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 73 507 3 14
Genomic Location (Zv9):
Chromosome 25 (position 29822598)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28512692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCTTGCCTCTAAAGTACATGTATTTTTAAATATTTTGGGTCTTCAGTTG[A/T]AAGAAAAGCTGTCGTCTAACCTAACCAAGGCCACAGAGAGACTACAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 229 507 4 14
Genomic Location (Zv9):
Chromosome 25 (position 29823146)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28513240
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGATGTGGCGATGACGTTATGCTCAACTCAGGAAGAACTAGATGTGCTC[A/T]AAAGTCAACAGCAAGAGAAAGACGGAGTATGTTTTTGATTTAATCATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Essential Splice Site 272 507 6 14
Genomic Location (Zv9):
Chromosome 25 (position 29823865)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28513959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTKAAATYCTGAAGAAGGAYGGACATCAGATTTTTTYCCCCATGTTTTTC[A/T]GGAGTCACAACAGAGTRATAAAGTCCAGAARCTGGAGAAGCTGCTCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 293 507 6 14
Genomic Location (Zv9):
Chromosome 25 (position 29823931)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28514025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TRATAAAGTCCAGAARCTGGAGAAGCTGCTCTCAARGAAGGAAAAGGAAT[T/A]GATGGAAAAGTATGTACAKCTATCTATCTATCTAWCTATCTATCTATCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123347 Nonsense 432 507 12 14
Genomic Location (Zv9):
Chromosome 25 (position 29839118)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 28529212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATGTGAAAYGTGTTCTATTCAGATCTTCAGTGTTCCCAAGAAGACCTTA[C/A]TTGGCTGATAATTTGGTCCAAAATGCTTCAGATATTAAGGTAAACAWGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link