cubn

Ensembl ID:
ENSDARG00000087013
ZFIN ID:
ZDB-GENE-060228-6
Description:
Cubn protein [Source:UniProtKB/TrEMBL;Acc:B0JZN9]
Human Orthologue:
CDCP2
Human Description:
CUB domain containing protein 2 [Source:HGNC Symbol;Acc:27297]
Mouse Orthologue:
Cdcp2
Mouse Description:
CUB domain containing protein 2 Gene [Source:MGI Symbol;Acc:MGI:3045328]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25216 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa25216
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124198 Essential Splice Site 224 420 4 8
Genomic Location:
Chromosome 24 (position 33279526)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTTGAGGCTGGAGGACCAAAGTACCTGCGCATTTGACTTTGTTGAGG[T/C]GAGGTTATCTGTATGTTTTAAAGGGGGTCATCCTGTTAAATACTTTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1xyjeh58