ENSDARG00000087009

Ensembl ID:
ENSDARG00000087009
Human Orthologues:
AC010606.5, AC137896.1, AL008728.1, AL138918.1, DMP1
Human Description:
dentin matrix acidic phosphoprotein 1 [Source:HGNC Symbol;Acc:2932]
Mouse Orthologue:
Dmp1
Mouse Description:
dentin matrix protein 1 Gene [Source:MGI Symbol;Acc:MGI:94910]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25911 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127193 Nonsense 301 349 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 47442987)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47448159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGAGGATGATGAAGATGATGGAAAGTTTGGTGCTGCAGGTGAGGATGAT[G/T]AAGATGGGGGAGAGTTTGGTGATGGTGAAGATGATGGTGCTGCAGGTGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link