Q7ZW49_DANRE

Ensembl ID:
ENSDARG00000086991
Description:
Pbx1a protein [Source:UniProtKB/TrEMBL;Acc:Q7ZW49]
Human Orthologue:
PBX2
Human Description:
pre-B-cell leukemia homeobox 2 [Source:HGNC Symbol;Acc:8633]
Mouse Orthologue:
Pbx2
Mouse Description:
pre B-cell leukemia transcription factor 2 Gene [Source:MGI Symbol;Acc:MGI:1341793]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14134 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14134
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123426 Nonsense 24 102 1 2
Genomic Location (Zv9):
Chromosome 2 (position 19618640)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19181228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGWTGCACTCTTCTCACGGGGTGGGCATGGCCGGACACCCYGGCTTGGCG[C/T]AGCAKATGCAGGATGGCACGGGAGGAGCGGACGACGAGGGAAGAAAACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Asthma: Genome-wide association study identifies three new susceptibility loci for adult asthma in the Japanese population. (View Study)
  • Crohn's disease: A genome-wide association study identifies 2 susceptibility Loci for Crohn's disease in a Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link