si:ch211-204d18.1

Ensembl ID:
ENSDARG00000086990
ZFIN ID:
ZDB-GENE-070912-183
Human Orthologue:
LRRC16B
Human Description:
leucine rich repeat containing 16B [Source:HGNC Symbol;Acc:20272]
Mouse Orthologue:
Lrrc16b
Mouse Description:
leucine rich repeat containing 16B Gene [Source:MGI Symbol;Acc:MGI:2448573]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13993 Essential Splice Site Available for shipment Available now
sa19830 Essential Splice Site Available for shipment Available now
sa32986 Essential Splice Site Mutation detected in F1 DNA During 2017
sa6857 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 661 1384 None 40
ENSDART00000141850   None 152 None 5
ENSDART00000147939 Essential Splice Site 337 536 None 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38551574)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38881739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCAGGCGTACCGCAGCTCCCCYGACAGGACAGAACAGGCACTGACCAAGG[T/A]GAGAATATTGCTTTTGAAAAAGGGGGMTAGGARGATTTATTCAATATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19830
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 831 1384 27 40
ENSDART00000141850   None 152 None 5
ENSDART00000147939 Essential Splice Site 507 536 15 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38565601)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38895766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCACCGCTCTGATGGAGAGAGCGGCGCAAGACATCAACAGAGCTCTGGA[G/T]TAAGAAACACTATAGGGCAGGGGTTCCTGGAGATCTACCTTCCTACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32986
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 897 1384 29 40
ENSDART00000141850   None 152 None 5
ENSDART00000147939   None 536 None 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38567114)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38897279
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACGCAGACATGCTGGACGTAGTGGAGGACGACTTCGGCATCAGCATAG[T/A]AAGTGTGTTACATGAATCACTCGTGTGTTTACAGTATCTGTCATCTCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127934 Essential Splice Site 1311 1384 37 40
ENSDART00000141850 Essential Splice Site 79 152 2 5
ENSDART00000147939   None 536 None 16

The following transcripts of ENSDARG00000086990 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 38585679)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38915844
KASP Assay ID:
554-5166.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTAAGCCTGTGTTTCATTCCACTTCAGTAGATTCTGCTTTACTTCAAGG[T/A]AATTCAGGGACAACATTGATGTTTAAATGTCATACTGGATGAGGCRATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link