ATXN1L

Ensembl ID:
ENSDARG00000086977
Description:
ataxin 1-like [Source:HGNC Symbol;Acc:33279]
Human Orthologue:
ATXN1L
Human Description:
ataxin 1-like [Source:HGNC Symbol;Acc:33279]
Mouse Orthologue:
Atxn1l
Mouse Description:
ataxin 1-like Gene [Source:MGI Symbol;Acc:MGI:3694797]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21147 Essential Splice Site Available for shipment Available now
sa21146 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21147
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127351 Essential Splice Site 299 651 2 6
ENSDART00000130304 Essential Splice Site 302 678 2 5
Genomic Location (Zv9):
Chromosome 7 (position 72139594)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69185441
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGAGAATGTCTCCTGGACAGAGCAGCACACCTGACACTGATCTCGAG[G/A]TAGGCTTATGTCAAGATCAGATTTTTTCATTGTGATTGTCAACCTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21146
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127351 Essential Splice Site 416 651 5 6
ENSDART00000130304   None 678 None 5
Genomic Location (Zv9):
Chromosome 7 (position 72133074)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 69178921
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACAGGGTCAGCAGGTGATTTCTGCCCCAGCTCCTGGTGCTTTTCCAC[A/T]AGCTCCTCTGCTAGCACCCACCGGCCCATCGCACTTCATGAAGGGCGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link