ATXN1L

Ensembl ID:
ENSDARG00000086977
Description:
ataxin 1-like [Source:HGNC Symbol;Acc:33279]
Human Orthologue:
ATXN1L
Human Description:
ataxin 1-like [Source:HGNC Symbol;Acc:33279]
Mouse Orthologue:
Atxn1l
Mouse Description:
ataxin 1-like Gene [Source:MGI Symbol;Acc:MGI:3694797]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21147 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21146 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21147
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127351 Essential Splice Site 299 651 2 6
ENSDART00000130304 Essential Splice Site 302 678 2 5
Genomic Location:
Chromosome 7 (position 72139594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGGAGAATGTCTCCTGGACAGAGCAGCACACCTGACACTGATCTCGAG[G/A]TAGGCTTATGTCAAGATCAGATTTTTTCATTGTGATTGTCAACCTCAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21146
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127351 Essential Splice Site 416 651 5 6
ENSDART00000130304 None None 678 None 5
Genomic Location:
Chromosome 7 (position 72133074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACAGGGTCAGCAGGTGATTTCTGCCCCAGCTCCTGGTGCTTTTCCAC[A/T]AGCTCCTCTGCTAGCACCCACCGGCCCATCGCACTTCATGAAGGGCGCCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/i6a438d5