C10orf71 (1 of 2)

Ensembl ID:
ENSDARG00000086970
Description:
chromosome 10 open reading frame 71 [Source:HGNC Symbol;Acc:26973]
Human Orthologue:
C10orf71
Human Description:
chromosome 10 open reading frame 71 [Source:HGNC Symbol;Acc:26973]
Mouse Orthologue:
3425401B19Rik
Mouse Description:
RIKEN cDNA 3425401B19 gene Gene [Source:MGI Symbol;Acc:MGI:3588196]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4511 Nonsense Mutation detected in F1 DNA During 2014
sa16604 Nonsense Available for shipment Available now
sa12297 Nonsense Available for shipment Available now
sa17126 Nonsense Available for shipment Available now
sa18600 Nonsense Available for shipment Available now
sa18475 Nonsense Available for shipment Available now
sa4510 Nonsense F2 line generated During 2014
sa13671 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4511
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 552 3591 1 1
Genomic Location:
Chromosome 13 (position 31158016)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAACTCAATCCGAGAGCCCAGTGCAGCCCTTAACACCCTTAAAGATTA[T/A]ACTGATGGCTTTGGATCATATGATAATTTGACATTAAATTCACCTCAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16604
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 1622 3591 1 1
Genomic Location:
Chromosome 13 (position 31154808)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GARATGAAGACATKACAAAGTCTTTGCTCTATTTCAATAAWGAAGATGTA[C/T]AAGCATTARCTAWCAAAAACATTAAAWCAAAGGAAAATGTTTTGGATAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 1673 3591 1 1
Genomic Location:
Chromosome 13 (position 31154655)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGATGGACAGTCAGTCAAAACTAGAAACARGTAAAGAATCCCTARCA[C/T]AAATGGCATCAGTTAAAGCAAAARAAAAANTCTATGCAAAAWGAACTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17126
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 2171 3591 1 1
Genomic Location:
Chromosome 13 (position 31153159)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCTAGCAAAGTGGAGTCTGCAGAGGAGCCGAWGATTTACAATATYTG[T/A]GTGTCAAGCAAAACGGAAGCAGCCTCAGAYGATGAGCCCATGATCTACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 2829 3591 1 1
ENSDART00000128847 Nonsense 2829 3591 1 1
Genomic Location:
Chromosome 13 (position 31151187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTCTCGAAGGAAAGCAAGTAAAACATATTGAAGCTACTGAGACAAAA[C/T]AAGCTCATCAACCTAATACAAACCAGAATCAGCCTGGGAGAGGTTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18475
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 2829 3591 1 1
ENSDART00000128847 Nonsense 2829 3591 1 1
Genomic Location:
Chromosome 13 (position 31151187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGTCTCGAAGGAAAGCAAGTAAAACATATTGAAGCTACTGAGACAAAA[C/T]AAGCTCATCAACCTAATACAAACCAGAATCAGCCTGGGAGAGGTTTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4510
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 2854 3591 1 1
Genomic Location:
Chromosome 13 (position 31151110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAGCCTGGGAGAGGTTTGGAGCCTGAAAAAGAAAGAAGTGCAAGCTA[T/A]GAACTAGAACATGCACAGATATATCAAAAGGACGCCAAGAAAGAAGGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128847 Nonsense 3490 3591 1 1
Genomic Location:
Chromosome 13 (position 31149202)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGGGTGCTYTAACACAGCCAGCACMAGTTGAAATGTTAAATGCTCCTTA[C/A]ATGCTGTATCGTGGCTTTCTGCCAATGGCTGCATCCTCATTATCACCCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r0zzpw1p