ENSDARG00000086969

Ensembl ID:
ENSDARG00000086969
Human Orthologues:
PCDHB1, PCDHG@, PCDHGA1, PCDHGA10, PCDHGA11, PCDHGA12, PCDHGA3, PCDHGA5, PCDHGA6, PCDHGA7, PCDHGA8
Human Descriptions:
protocadherin beta 1 [Source:HGNC Symbol;Acc:8680]
protocadherin gamma cluster [Source:HGNC Symbol;Acc:8695]
protocadherin gamma subfamily A, 1 [Source:HGNC Symbol;Acc:8696]
protocadherin gamma subfamily A, 10 [Source:HGNC Symbol;Acc:8697]
protocadherin gamma subfamily A, 11 [Source:HGNC Symbol;Acc:8698]
protocadherin gamma subfamily A, 12 [Source:HGNC Symbol;Acc:8699]
protocadherin gamma subfamily A, 3 [Source:HGNC Symbol;Acc:8701]
protocadherin gamma subfamily A, 5 [Source:HGNC Symbol;Acc:8703]
protocadherin gamma subfamily A, 6 [Source:HGNC Symbol;Acc:8704]
protocadherin gamma subfamily A, 7 [Source:HGNC Symbol;Acc:8705]
protocadherin gamma subfamily A, 8 [Source:HGNC Symbol;Acc:8706]
Mouse Orthologue:
Pcdhb1
Mouse Description:
protocadherin beta 1 Gene [Source:MGI Symbol;Acc:MGI:2136730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27597 Nonsense Mutation detected in F1 DNA During 2017
sa27598 Nonsense Mutation detected in F1 DNA During 2017
sa27599 Nonsense Mutation detected in F1 DNA During 2017
sa38796 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27597
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128215 Nonsense 99 782 1 2
Genomic Location (Zv9):
Chromosome 10 (position 21966181)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21796709
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCAGTGTAAGTTTTGATGTGATTTTGGAGAATCCGATGGAGCTTTAT[C/T]GAGTAACAGTTGACATACAAGACATCAATGACAACAGCCCCGTCTTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27598
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128215 Nonsense 149 782 1 2
Genomic Location (Zv9):
Chromosome 10 (position 21966331)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21796859
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTTCCATTAGAGAGCGCGGTAGATCCAGACGTGGGAGTGAACGCGCTA[C/T]AAAAATACACTCTTCAACCCACCGACCATTTTAAGCTTAATGTTCAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128215 Nonsense 457 782 1 2
Genomic Location (Zv9):
Chromosome 10 (position 21967255)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21797783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATAGCTGAAAATAACCCACCATCTACGACTATTCTGACTGTCAAAGCA[G/T]AAGACATGGACTGGGGGCCGAATGCAAAGGTCTCATACTTTCTTATCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38796
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128215 Nonsense 750 782 1 2
Genomic Location (Zv9):
Chromosome 10 (position 21968136)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21798664
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGGACCACAGACTCAAGGATGAGTGACGTAAAGTTTGTCAGGCCCTA[C/A]AGTCAGAACACACTGGTCAGCCAGAGTCGTTTGGGGACAGTTCAGAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link