LOC568576

Ensembl ID:
ENSDARG00000086947
Human Orthologue:
OLFM4
Human Description:
olfactomedin 4 [Source:HGNC Symbol;Acc:17190]
Mouse Orthologues:
E030002O03Rik, Olfm4
Mouse Descriptions:
olfactomedin 4 Gene [Source:MGI Symbol;Acc:MGI:2685142]
RIKEN cDNA E030002O03 gene Gene [Source:MGI Symbol;Acc:MGI:2443346]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24622 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125754 Nonsense 28 495 1 5
Genomic Location:
Chromosome 25 (position 12762268)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATAGCCCCTGGAAAAGTCATATTTGCATAACTAAAATTGCGACATCT[C/T]AGTGTTTATGTGGAGATTTAAAGCTGATCACTAGTCTTTCAACGCATTTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cfkdlf3m