PIK3C2B

Ensembl ID:
ENSDARG00000086927
Description:
phosphoinositide-3-kinase, class 2, beta polypeptide [Source:HGNC Symbol;Acc:8972]
Human Orthologue:
PIK3C2B
Human Description:
phosphoinositide-3-kinase, class 2, beta polypeptide [Source:HGNC Symbol;Acc:8972]
Mouse Orthologue:
Pik3c2b
Mouse Description:
phosphoinositide-3-kinase, class 2, beta polypeptide Gene [Source:MGI Symbol;Acc:MGI:2685045]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15973 Nonsense Available for shipment Available now
sa30947 Nonsense Mutation detected in F1 DNA During 2017
sa41828 Nonsense Mutation detected in F1 DNA During 2017
sa18222 Nonsense Available for shipment Available now
sa35077 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa15973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124810 Nonsense 44 1598 1 32
Genomic Location (Zv9):
Chromosome 11 (position 24607860)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23447260
KASP Assay ID:
2260-4250.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGAATCGCTCGGCCTCAGCCAAAAGGAGCTGGTCCTTGCAGAGGCCT[T/A]GCAAATGGAGTATGACGCCCTTGCCCGTCATCGAMAGGACAAGGGCACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30947
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124810 Nonsense 168 1598 1 32
ENSDART00000124810 Nonsense 168 1598 1 32
Genomic Location (Zv9):
Chromosome 11 (position 24607489)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23446889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTCTGGATGAGCCTCCCCCACCGGTACCGCCCAGAAATCCAATCCCC[C/T]AAAATGATCCATTCATTGTCCATAGAAGTTCAGCACCACGGGATGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124810 Nonsense 168 1598 1 32
ENSDART00000124810 Nonsense 168 1598 1 32
Genomic Location (Zv9):
Chromosome 11 (position 24607489)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23446889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACTCTGGATGAGCCTCCCCCACCGGTACCGCCCAGAAATCCAATCCCC[C/T]AAAATGATCCATTCATTGTCCATAGAAGTTCAGCACCACGGGATGTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124810 Nonsense 632 1598 11 32
Genomic Location (Zv9):
Chromosome 11 (position 24568680)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23408080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCACCCATGGCGGCGTGGAGCTTTGTGCCCCTCAACACAMCAGTAAA[C/T]AGTCGGTCAGCAAATATCTCTTCCACCTGGTGGTGTGGGACCAGAGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124810 Essential Splice Site 741 1598 13 32
Genomic Location (Zv9):
Chromosome 11 (position 24564860)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 23404260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCGCTCCAGTACACCAAACTTCAGCCAGCCTGACAGCGTCATCCTACAG[G/T]TTCGGCTTTTTGCTTTTGTGTAATCATAGAGTAAAATGTTTCCTGCTTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link