ENSDARG00000086918

Ensembl ID:
ENSDARG00000086918
Mouse Orthologue:
Pecam1
Mouse Description:
platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI Symbol;Acc:MGI:97537]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38548 Nonsense Mutation detected in F1 DNA During 2016
sa9482 Nonsense Available for shipment Available now
sa18840 Nonsense Mutation detected in F1 DNA During 2016
sa20681 Nonsense Available for shipment Available now
sa20680 Nonsense Available for shipment Available now
sa26725 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129504 Nonsense 253 686 5 12
Genomic Location (Zv9):
Chromosome 6 (position 19743699)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21695372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCATTGAAGGAGACCTCCTAACCTTCAGCTGCAATGTGGATATGACTTA[T/A]CAAAAAAATTCTGAACTTAGAATCAGTCTTGTCCATGGACATACCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129504 Nonsense 260 686 5 12
ENSDART00000129504 Nonsense 260 686 5 12
Genomic Location (Zv9):
Chromosome 6 (position 19743680)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21695391
KASP Assay ID:
2259-7416.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAACCTTCAGCTGCAATGTGGATATGACTTATCAAAAAAATTCWGAACTT[A/T]GAATCAGTCTTGTCCATGGACATACCACACTCGGTTTGAATATGRGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129504 Nonsense 260 686 5 12
ENSDART00000129504 Nonsense 260 686 5 12
Genomic Location (Zv9):
Chromosome 6 (position 19743680)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21695391
KASP Assay ID:
2259-7416.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCTTCAGCTGCAATGTGGATATGACTTATCAAAAAAATTCTGAACTT[A/T]GAATCAGTCTTGTCCATGGACATACCACACTCGGTTTGAATATGGGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20681
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129504 Nonsense 277 686 5 12
Genomic Location (Zv9):
Chromosome 6 (position 19743629)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21695442
KASP Assay ID:
2259-7415.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATCAGTCTTGTCCATGGACATACCACACTCGGTTTGAATATGGGACAG[A/T]AAACTTACAATATGTCTGCTAAAGCCAATGACTCTGGGCAATATGAGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20680
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129504 Nonsense 476 686 7 12
Genomic Location (Zv9):
Chromosome 6 (position 19742707)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21696364
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTATAGCCATGATATCAGCTCCCTCAGACATCAGCAGTTACTTTTGT[G/T]AAGCAGAGAATAATGGCAAAATCTCAGTCAAGATGAGTCAAAGGCTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26725
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129504 Essential Splice Site 624 686 10 12
Genomic Location (Zv9):
Chromosome 6 (position 19729462)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 21709609
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCAAATAAATGCTTGCACTTCAAATGCAATAATTTTGCTGTTTTTC[A/T]GTGGGAGTTAATAATAAAGAAAGTGTTTGGAGTGAAAAACCTCCAGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link