si:dkey-100n23.5

Ensembl ID:
ENSDARG00000086911
ZFIN ID:
ZDB-GENE-070912-347

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41447 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41447
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129926 Nonsense 79 349 4 13
ENSDART00000139106 Nonsense 73 236 4 11
ENSDART00000140585 Nonsense 86 251 4 11
ENSDART00000144259 Nonsense 33 127 4 8
ENSDART00000145052 Nonsense 49 217 4 12

The following transcripts of ENSDARG00000086911 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 31290996)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 30446942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGGTGATCAACCTGACAGTAGCTGCATTGTTTGACAGTGTTGCTTA[T/A]GTTATGGTAAGTTACACTGATTTGTCTGTACAAATGTTTCCCTTATCTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link