dock1

Ensembl ID:
ENSDARG00000086908
ZFIN ID:
ZDB-GENE-080108-5
Description:
dedicator of cytokinesis protein 1 [Source:RefSeq peptide;Acc:NP_001103481]
Human Orthologue:
DOCK1
Human Description:
dedicator of cytokinesis 1 [Source:HGNC Symbol;Acc:2987]
Mouse Orthologue:
Dock1
Mouse Description:
dedicator of cytokinesis 1 Gene [Source:MGI Symbol;Acc:MGI:2429765]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31895 Nonsense Mutation detected in F1 DNA During 2017
sa28010 Nonsense Mutation detected in F1 DNA During 2017
sa6272 Nonsense Mutation detected in F1 DNA During 2017
sa6271 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109740 Nonsense 388 727 12 27
Genomic Location (Zv9):
Chromosome 12 (position 44652749)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43505651
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACCAAGCTGGATCACGAGGTGGAGGGAGGCCGCGGAGATGAACAGTAC[A/T]AAATCCTCTTCCAGAAGATGTGAGCGCACACACACAAGCACACACTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28010
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109740 Nonsense 393 727 12 27
Genomic Location (Zv9):
Chromosome 12 (position 44652734)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43505636
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGGTGGAGGGAGGCCGCGGAGATGAACAGTACAAAATCCTCTTCCAG[A/T]AGATGTGAGCGCACACACACAAGCACACACTCATAGCCCTACTACACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6272
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109740 Nonsense 420 727 13 27
Genomic Location (Zv9):
Chromosome 12 (position 44650181)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43503083
KASP Assay ID:
554-4526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATCTGGCTAAGACTGGTGAAACCTTCGTGACTCTGGTGGTGCGTCTGT[T/A]GGAGAGACTCCTGGACTACAGGACCATCATGCATGATGAAAACAAGGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6271
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109740 Nonsense 646 727 25 27
Genomic Location (Zv9):
Chromosome 12 (position 44608325)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 43461227
KASP Assay ID:
554-5313.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNAATGTTTTGGTTGTTGTTTCTTAGTGTGGTTTAAACAGACATTCAGTG[T/A]TTCACAGTGAAGCCYTTGCTAGAACTACCACCAAAATTTCAAAACAAACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link