LOC560601

Ensembl ID:
ENSDARG00000086905
Human Orthologue:
SLC24A6
Human Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 6 [Source:HGNC Symbol;Acc:2617
Mouse Orthologue:
Slc24a6
Mouse Description:
solute carrier family 24 (sodium/potassium/calcium exchanger), member 6 Gene [Source:MGI Symbol;Acc:

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10738 Essential Splice Site Available for shipment Available now
sa21030 Essential Splice Site Available for shipment Available now
sa27007 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa10738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129243 Essential Splice Site 105 291 2 8
Genomic Location (Zv9):
Chromosome 7 (position 40770780)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39107037
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTTGCCTATTCACACCAAGTCTTCTGCCCCTAGCCATCACGATCTATG[T/C]AAGGAAACATTTGGCTTAGTCATCAAAAACGTTAACTGGTTGCATATCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21030
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129243 Essential Splice Site 177 291 5 8
Genomic Location (Zv9):
Chromosome 7 (position 40768192)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39104449
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTCTCTCACCCTCAAACTGCTGGTCTGGCCATTGGAGCACTTTTTG[G/A]TGAGGAATTAGCTCTGTTAAACATACACCAAAATTTACTTACTCAAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129243 Essential Splice Site 178 291 6 8
Genomic Location (Zv9):
Chromosome 7 (position 40766436)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 39102693
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTATTTTGTTTTTTGTTGTGACTTACTCTATGTTTCTTAATTGCTTTTTT[A/G]GGAGCGGGAATCTTTGTTACAACAGTGGTCGCGGGGAGTGTTGCTCTGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link