CCD23_DANRE

Ensembl ID:
ENSDARG00000086898
Description:
Coiled-coil domain-containing protein 23 [Source:UniProtKB/Swiss-Prot;Acc:P0C8M3]
Human Orthologue:
CCDC23
Human Description:
coiled-coil domain containing 23 [Source:HGNC Symbol;Acc:29204]
Mouse Orthologue:
Ccdc23
Mouse Description:
coiled-coil domain containing 23 Gene [Source:MGI Symbol;Acc:MGI:1916466]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32562 Nonsense Available for shipment Available now
sa24795 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32562
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125786 Nonsense 18 65 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA732 (position 125947)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41732925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCCAGCATGTCGAAAAGACAAACAGAAACAGCAAACACCAACGCGT[G/T]GAGACAGAACGAAACAGAAAACAGCCCAGCAGGAGCTGAAGCAGAGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24795
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125786 Nonsense 20 65 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA732 (position 125941)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 41732931
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCATGTCGAAAAGACAAACAGAAACAGCAAACACCAACGCGTGGAGAC[A/T]GAACGAAACAGAAAACAGCCCAGCAGGAGCTGAAGCAGAGACAGAGAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link