PDZRN4 (1 of 2)

Ensembl ID:
ENSDARG00000086878
Description:
PDZ domain containing ring finger 4 [Source:HGNC Symbol;Acc:30552]
Human Orthologue:
PDZRN4
Human Description:
PDZ domain containing ring finger 4 [Source:HGNC Symbol;Acc:30552]
Mouse Orthologue:
Pdzrn4
Mouse Description:
PDZ domain containing RING finger 4 Gene [Source:MGI Symbol;Acc:MGI:3056996]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25444 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25444
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129735 Essential Splice Site 183 310 1 2
Genomic Location (Zv9):
Chromosome Zv9_NA498 (position 4074)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150254.1 4074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACAATAAGATGGAGTGGAAGGTGAAGGTGCGGAGCGACGGGACCAGG[T/C]ACACACTGATCACCCTCATCTATCATTAACAGTCTGAAGCACACCACTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link