si:ch211-232i5.3

Ensembl ID:
ENSDARG00000086874
ZFIN ID:
ZDB-GENE-091204-88

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17120 Nonsense Available for shipment Available now
sa32275 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa17120
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122902 Nonsense 11 250 1 11
ENSDART00000141419   None 86 None 4
Genomic Location (Zv9):
Chromosome 20 (position 8272611)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8106880
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTAACTCATGGTGTTTAATGCAGATYACAGGCCAAGAAGAGCCCATATA[T/A]CATGTTAAAGTGATYGAGGARTGTAAAGGCCGTAAAAATGACCTGCCGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122902 Essential Splice Site 189 250 8 11
ENSDART00000141419   None 86 None 4
Genomic Location (Zv9):
Chromosome 20 (position 8263465)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 8097734
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTAAGTCATCATGTTTTTTGTCTACTTCCTGTTTCCTTATATGGTACTT[A/G]GTGCTTCAAGAATGCCAGACCCAAAACCAGGTATGTTTTGACTCTTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link