CARD14

Ensembl ID:
ENSDARG00000086871
Description:
caspase recruitment domain family, member 14 [Source:HGNC Symbol;Acc:16446]
Human Orthologue:
CARD14
Human Description:
caspase recruitment domain family, member 14 [Source:HGNC Symbol;Acc:16446]
Mouse Orthologue:
Card14
Mouse Description:
caspase recruitment domain family, member 14 Gene [Source:MGI Symbol;Acc:MGI:2386258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10788 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10788
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126733 Nonsense 229 308 7 8
Genomic Location:
Chromosome 3 (position 4023396)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAGCTGGGCTTGAATCATGTGGAGAATCTCCTGAAGCAGAGCATCTA[T/A]CCCATAATAATCCACATCAAACCCAAAGACAAGAARGGACGCAAGTTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/18ysain7