ENSDARG00000086857

Ensembl ID:
ENSDARG00000086857
Human Orthologue:
AC118759.1
Human Description:
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A6NP22]
Mouse Orthologue:
Prol1
Mouse Description:
proline rich, lacrimal 1 Gene [Source:MGI Symbol;Acc:MGI:107496]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30261 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30261
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127416 Essential Splice Site 92 179 5 10
Genomic Location (Zv9):
Chromosome 25 (position 23936381)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 23115494
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAACAACAGCTTCTACATCAACTGTGTTACCAACATCATTTCCTTCAA[G/A]TGAGTATTTTAATTCATAAACAATTTTGTAAACATTTAAATTGGAAAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link